pBRC169-DXMT
(Plasmid
#79822)
-
PurposeDsREDmonomer-based BiFC vector for plants (Positive control: DXMT)
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79822 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCaMV35S- sGFP(S65T)-NOS vector
-
Backbone manufacturerChiu W
- Backbone size w/o insert (bp) 4180
-
Modifications to backbonecDNA fragments of CaDXMT1 (Uefuji et al. 2003) were subcloned into the BsrGI site of pBRC169 vectors by the in-fusion method (Clontech).
-
Vector typePlant Expression ; Reporter plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCaDXMT1
-
Alt nameDXMT
-
SpeciesSynthetic
-
Insert Size (bp)1155
- Promoter CaMV 35S promoter
-
Tag
/ Fusion Protein
- RC169/DsREDmonomer (169–225) (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TATATGTACAAGATGGAGCTCCAAGAAGTC
- 3′ sequencing primer TATAGCGGCCGCTTACATGTCTGCCTTCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBRC169-DXMT was a gift from Yutaka Kodama & Masamitsu Wada (Addgene plasmid # 79822 ; http://n2t.net/addgene:79822 ; RRID:Addgene_79822) -
For your References section:
Simultaneous visualization of two protein complexes in a single plant cell using multicolor fluorescence complementation analysis. Kodama Y, Wada M. Plant Mol Biol. 2009 May;70(1-2):211-7. doi: 10.1007/s11103-009-9467-0. Epub 2009 Feb 14. 10.1007/s11103-009-9467-0 PubMed 19219406