PmarA-cfp
(Plasmid
#79867)
-
PurposeDegradation tagged CFP fluorescent reporter for MarA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelow-copy (SC101) origin vector pBbS5k
-
Backbone manufacturerBglBrick vectors
- Backbone size w/o insert (bp) 3493
- Total vector size (bp) 4445
-
Modifications to backboneRemoved the extraneous copy of lacI and its promoter from the pBbS5k plasmid
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameA modified marRAB promoter upstream of a degradation tagged cfp
-
Insert Size (bp)952
- Promoter modified marRAB promoter with inactivated MarR binding sites
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAGTTTACTTTGCAGGGCTTC
- 3′ sequencing primer GGCAATTCTGGAAGAAATAGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PmarA-cfp was a gift from Mary Dunlop (Addgene plasmid # 79867 ; http://n2t.net/addgene:79867 ; RRID:Addgene_79867) -
For your References section:
Stochastic expression of a multiple antibiotic resistance activator confers transient resistance in single cells. El_Meouche I, Siu Y, Dunlop MJ. Sci Rep. 2016 Jan 13;6:19538. doi: 10.1038/srep19538. 10.1038/srep19538 PubMed 26758525