PmarA-cfp
(Plasmid #79867)

• Purpose: Degradation tagged CFP fluorescent reporter for MarA
• Depositing Lab: Mary Dunlop
• Publication: El_Meouche et al Sci Rep. 2016 Jan 13;6:19538. doi: 10.1038/srep19538.

Backbone

• Vector backbone: low-copy (SC101) origin vector pBbS5k
• Backbone manufacturer: BglBrick vectors
• Backbone size w/o insert (bp): 3493
• Total vector size (bp): 4445
• Modifications to backbone: Removed the extraneous copy of lacI and its promoter from the pBbS5k plasmid
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: A modified marRAB promoter upstream of a degradation tagged cfp
• Insert Size (bp): 952
• Promoter: modified marRAB promoter with inactivated MarR binding sites

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CAGTTTACTTTGCAGGGCTTC
• 3′ sequencing primer: GGCAATTCTGGAAGAAATAGCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry