Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pGEM-NLS-BirA-2A-mCherry-SV40pA-FKF
(Plasmid #79889)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79889 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEM-T
  • Backbone size w/o insert (bp) 2994
  • Total vector size (bp) 6643
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HA-tagged NLS-BirA, 2A, mCherry protein and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    3649

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer ATTTAGGTGACACTATAGAA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEM-NLS-BirA-2A-mCherry-SV40pA-FKF was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 79889 ; http://n2t.net/addgene:79889 ; RRID:Addgene_79889)
  • For your References section:

    Biotagging of Specific Cell Populations in Zebrafish Reveals Gene Regulatory Logic Encoded in the Nuclear Transcriptome. Trinh LA, Chong-Morrison V, Gavriouchkina D, Hochgreb-Hagele T, Senanayake U, Fraser SE, Sauka-Spengler T. Cell Rep. 2017 Apr 11;19(2):425-440. doi: 10.1016/j.celrep.2017.03.045. 10.1016/j.celrep.2017.03.045 PubMed 28402863