AAVS1_Puro_PGK1_3xFLAG_Twin_Strep_EZH2
(Plasmid
#79902)
-
PurposeGene Addition of 3xFLAG_Twin_Strep_EZH2 to the AAVS1 Genomic Safe Harbor Locus
-
Depositing Lab
-
Depositing OrganizationUniversite Laval
Located in Canada -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79902 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 79902-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 79902-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAAVS1_Puro_PGK1_3xFLAG_Twin_Strep (Plasmid #68375)
-
Vector typeMammalian Expression, CRISPR, TALEN
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xFLAG_Twin_Strep_EZH2
-
SpeciesH. sapiens (human)
- Promoter PGK1
-
Tag
/ Fusion Protein
- 3xFLAG_Twin_Strep (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tagtgtgggccctgttcctg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use in combination with eSpCas9(1.1)_No_FLAG_AAVS1_T2 (Plasmid #79888)
DNA (Catalog # 79902-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 79902-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1_Puro_PGK1_3xFLAG_Twin_Strep_EZH2 was a gift from Yannick Doyon (Addgene plasmid # 79902 ; http://n2t.net/addgene:79902 ; RRID:Addgene_79902) -
For your References section:
A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells. Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Cote J, Doyon Y. Cell Rep. 2015 Oct 7. pii: S2211-1247(15)01020-7. doi: 10.1016/j.celrep.2015.09.009. 10.1016/j.celrep.2015.09.009 PubMed 26456817
Map uploaded by the depositor.
