Skip to main content
Addgene

rgef-1p::NmBirA
(Plasmid #79971)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79971 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBD95
  • Backbone manufacturer
    Vidal et al
  • Backbone size w/o insert (bp) 7059
  • Total vector size (bp) 8349
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BirA
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1170
  • Promoter rgef
  • Tag / Fusion Protein
    • NLS::myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer atgaaggataatactgttcc
  • 3′ sequencing primer ggaaacagttatgtttggtatattgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    rgef-1p::NmBirA was a gift from Baris Tursun (Addgene plasmid # 79971 ; http://n2t.net/addgene:79971 ; RRID:Addgene_79971)
  • For your References section:

    A tissue-specific protein purification approach in Caenorhabditis elegans identifies novel interaction partners of DLG-1/Discs large. Waaijers S, Munoz J, Berends C, Ramalho JJ, Goerdayal SS, Low TY, Zoumaro-Djayoon AD, Hoffmann M, Koorman T, Tas RP, Harterink M, Seelk S, Kerver J, Hoogenraad CC, Bossinger O, Tursun B, van den Heuvel S, Heck AJ, Boxem M. BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x. 10.1186/s12915-016-0286-x PubMed 27506200