pX330-MGAT1-KO
(Plasmid
#80009)
-
PurposegRNA to knock out expression of MGAT1 gene. The product of this gene is essential for synthesis of complex and hybrid N-Glycans.
-
Depositing Lab
-
Depositing OrganizationUniversity at Buffalo (SUNY Buffalo)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 80009-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 80009-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
- Backbone size w/o insert (bp) 8506
- Total vector size (bp) 8526
-
Modifications to backboneGuide RNA for MGAT1 gene cloned in BbsI restriction site
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMGAT1
-
gRNA/shRNA sequenceGTGGGGCGCTATCCTCTTTG
-
SpeciesH. sapiens (human)
-
Entrez GeneMGAT1 (a.k.a. GLCNAC-TI, GLCT1, GLYT1, GNT-1, GNT-I, GnTI, MGAT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5'
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCloning vector, pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230), was produced in Dr. Feng Zhang's lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 80009-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 80009-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-MGAT1-KO was a gift from Sriram Neelamegham (Addgene plasmid # 80009 ; http://n2t.net/addgene:80009 ; RRID:Addgene_80009) -
For your References section:
Using CRISPR-Cas9 to quantify the contributions of O-glycans, N-glycans and Glycosphingolipids to human leukocyte-endothelium adhesion. Stolfa G, Mondal N, Zhu Y, Yu X, Buffone A Jr, Neelamegham S. Sci Rep. 2016 Jul 26;6:30392. doi: 10.1038/srep30392. 10.1038/srep30392 PubMed 27458028
