Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX330-UGCG-KO
(Plasmid #80010)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80010 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone size w/o insert (bp) 8506
  • Total vector size (bp) 8526
  • Modifications to backbone
    Guide RNA for UGCG gene cloned in BbsI restriction site
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UGCG
  • gRNA/shRNA sequence
    GCTGTGGCTGATGCATTTCA
  • Species
    H. sapiens (human)
  • Entrez Gene
    UGCG (a.k.a. GCS, GLCT1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cloning vector, pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230), was produced in Dr. Feng Zhang's lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-UGCG-KO was a gift from Sriram Neelamegham (Addgene plasmid # 80010 ; http://n2t.net/addgene:80010 ; RRID:Addgene_80010)
  • For your References section:

    Using CRISPR-Cas9 to quantify the contributions of O-glycans, N-glycans and Glycosphingolipids to human leukocyte-endothelium adhesion. Stolfa G, Mondal N, Zhu Y, Yu X, Buffone A Jr, Neelamegham S. Sci Rep. 2016 Jul 26;6:30392. doi: 10.1038/srep30392. 10.1038/srep30392 PubMed 27458028