-
PurposeGCaMP6 is a genetically encoded fluorescent Ca2+ sensor . TPC2-GCaMP6 allows the visualization of Ca2+ release from intracellular Ca2+ stores in real time
-
Depositing Lab
-
Depositing OrganizationColorado State University, Fort Collins
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 80147-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 80147-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGCaMP6m-N3
- Backbone size w/o insert (bp) 5353
- Total vector size (bp) 7609
-
Modifications to backboneEGFP in pEGFP-N3 was replaced by GCaMP6m (BamHI-NotI) to generate pGCaMP6m-N3
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTPCN2
-
Alt nameTPC2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2256
-
Entrez GeneTPCN2 (a.k.a. SHEP10, TPC2)
- Promoter CMV
-
Tag
/ Fusion Protein
- GCaMP6m (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CCTCTACAAATGTGGTATGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 80147-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 80147-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGCaMP6m-N3-TPC2 was a gift from Santiago Di Pietro (Addgene plasmid # 80147 ; http://n2t.net/addgene:80147 ; RRID:Addgene_80147) -
For your References section:
TPC2 mediates new mechanisms of platelet dense granule membrane dynamics through regulation of Ca2+ release. Ambrosio AL, Boyle JA, Di Pietro SM. Mol Biol Cell. 2015 Sep 15;26(18):3263-74. doi: 10.1091/mbc.E15-01-0058. Epub 2015 Jul 22. 10.1091/mbc.E15-01-0058 PubMed 26202466