-
PurposeLentiviral transfer vector under the CMV promoter that expresses smURFP and mCardinal.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80348 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti
-
Backbone manufacturerDeisseroth / Boyden lab
- Backbone size w/o insert (bp) 9436
- Total vector size (bp) 9835
-
Modifications to backboneLentiviral transfer vector under the CMV promoter that expresses smURFP and mCardinal.
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsAny growth strain that avoids recombination and 30 ˚C is recommended to avoid loss of DNA upon propagation.
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namesmURFP
-
Alt namesmall Ultra-Red Fluorescent Protein
-
SpeciesSynthetic
-
Insert Size (bp)399
-
GenBank IDKX449134
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer Unnecessary
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCardinal
-
SpeciesSynthetic
-
Insert Size (bp)735
-
GenBank IDKJ131552
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGAGAATCCCGGCCCT
- 3′ sequencing primer CCAGTCAATCTTTCACAAATTTTGTAATCCAGAGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-smURFP-T2A-mCardinal was a gift from Erik Rodriguez & Roger Tsien (Addgene plasmid # 80348 ; http://n2t.net/addgene:80348 ; RRID:Addgene_80348) -
For your References section:
A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein. Rodriguez EA, Tran GN, Gross LA, Crisp JL, Shu X, Lin JY, Tsien RY. Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935. 10.1038/nmeth.3935 PubMed 27479328