pSKA397
(Plasmid
#80380)
-
Purposemini-Tn7 delivery plasmid with metE under the cpcG2Δ59 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80380 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC18R6KT-mini-Tn7T (Addgene #64958)
-
Backbone manufacturerChoi KH et al. 2005. Nature Methods, 2(6): 443-448.
- Backbone size w/o insert (bp) 3485
- Total vector size (bp) 7261
-
Vector typeBacterial Expression, Synthetic Biology ; mini-Tn7 delivery vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)CC118 (λpir)
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namecat
-
Alt namechloramphenicol acetyltransferase
-
SpeciesTn9
-
Insert Size (bp)660
- Promoter cat promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CGAAAAGTGCCACCTGAC
- 3′ sequencing primer GATAGAGAAAAGCACAATGGGCT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemetE
-
Alt namemethionine synthase
-
SpeciesE. coli
-
Insert Size (bp)2262
-
GenBank IDNC_000913.3
- Promoter cpcG2Δ59
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAGTTATTGGTGCCCTTAAAC
- 3′ sequencing primer CGCCCAAACATAACAGGAAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSKA397 was a gift from Mustafa Khammash (Addgene plasmid # 80380 ; http://n2t.net/addgene:80380 ; RRID:Addgene_80380) -
For your References section:
Automated optogenetic feedback control for precise and robust regulation of gene expression and cell growth. Milias-Argeitis A, Rullan M, Aoki SK, Buchmann P, Khammash M. Nat Commun. 2016 Aug 26;7:12546. doi: 10.1038/ncomms12546. 10.1038/ncomms12546 PubMed 27562138