Skip to main content
Addgene

pSKA397
(Plasmid #80380)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80380 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC18R6KT-mini-Tn7T (Addgene #64958)
  • Backbone manufacturer
    Choi KH et al. 2005. Nature Methods, 2(6): 443-448.
  • Backbone size w/o insert (bp) 3485
  • Total vector size (bp) 7261
  • Vector type
    Bacterial Expression, Synthetic Biology ; mini-Tn7 delivery vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    CC118 (λpir)
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    cat
  • Alt name
    chloramphenicol acetyltransferase
  • Species
    Tn9
  • Insert Size (bp)
    660
  • Promoter cat promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CGAAAAGTGCCACCTGAC
  • 3′ sequencing primer GATAGAGAAAAGCACAATGGGCT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    metE
  • Alt name
    methionine synthase
  • Species
    E. coli
  • Insert Size (bp)
    2262
  • GenBank ID
    NC_000913.3
  • Promoter cpcG2Δ59

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAGTTATTGGTGCCCTTAAAC
  • 3′ sequencing primer CGCCCAAACATAACAGGAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSKA397 was a gift from Mustafa Khammash (Addgene plasmid # 80380 ; http://n2t.net/addgene:80380 ; RRID:Addgene_80380)
  • For your References section:

    Automated optogenetic feedback control for precise and robust regulation of gene expression and cell growth. Milias-Argeitis A, Rullan M, Aoki SK, Buchmann P, Khammash M. Nat Commun. 2016 Aug 26;7:12546. doi: 10.1038/ncomms12546. 10.1038/ncomms12546 PubMed 27562138