pFA6a-pcr1M-natMX6-pcr2M
(Plasmid
#80621)
-
Purposeto delete part of the mat1-M locus and fix the mating type in natural S. pombe isolates
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80621 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFA6a-natMX6
-
Vector typeYeast Expression
-
Selectable markersnourseothricin (NAT)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePCR1 from mat1-M
-
SpeciesS. pombe (fission yeast)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer SP6
- 3′ sequencing primer TEFpro-R (gctaaatgtacgggcgacag) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePCR2 from mat1-M
-
SpeciesS. pombe (fission yeast)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer T7 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFA6a-pcr1M-natMX6-pcr2M was a gift from Miguel Godinho Ferreira (Addgene plasmid # 80621 ; http://n2t.net/addgene:80621 ; RRID:Addgene_80621) -
For your References section:
Genome architecture is a selectable trait that can be maintained by antagonistic pleiotropy. Avelar AT, Perfeito L, Gordo I, Ferreira MG. Nat Commun. 2013;4:2235. doi: 10.1038/ncomms3235. 10.1038/ncomms3235 PubMed 23974178