Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #80629)


Item Catalog # Description Quantity Price (USD)
Plasmid 80629 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Gary Nolan
  • Backbone size w/o insert (bp) 6940
  • Total vector size (bp) 7190
  • Modifications to backbone
    Blastcidin-S resistanct gene (bsr) behind IRES
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    Anguilla japonica
  • Insert Size (bp)
  • Mutation
    mutations A36V, R136G
  • GenBank ID
  • Promoter LTR
  • Tag / Fusion Protein
    • HA-mcherry-linker (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer Lab32 ATCGCAGCTTGGATACACGCC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry-FDD was a gift from Thomas Wandless (Addgene plasmid # 80629 ; ; RRID:Addgene_80629)
  • For your References section:

    A Novel Destabilizing Domain Based on a Small-Molecule Dependent Fluorophore. Navarro R, Chen LC, Rakhit R, Wandless TJ. ACS Chem Biol. 2016 Jun 6. 10.1021/acschembio.6b00234 PubMed 27243964