pProm11_BCD1-GFP
(Plasmid
#80656)
-
PurposePromoter11 with BCD1-gfp
-
Depositing Lab
-
Depositing OrganizationLawrence Berkeley National Laboratory
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 80656-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 80656-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneN/A
-
Backbone manufacturerN/A
- Total vector size (bp) 2341
-
Modifications to backbonen/a
-
Vector typep15A origin, constitutive promoter, KanR
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Growth instructionsMedium copy
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
-
Alt namesfGFP
-
Insert Size (bp)717
-
MutationNONE
- Promoter constitutive promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer QB3284_Fwd CGATCCTCATCCTGTCTCTTGATC
- 3′ sequencing primer QB3810_Rev CGAGCGTAGCGAGTCAGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 80656-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 80656-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pProm11_BCD1-GFP was a gift from Nathan Hillson (Addgene plasmid # 80656 ; http://n2t.net/addgene:80656 ; RRID:Addgene_80656) -
For your References section:
PR-PR: cross-platform laboratory automation system. Linshiz G, Stawski N, Goyal G, Bi C, Poust S, Sharma M, Mutalik V, Keasling JD, Hillson NJ. ACS Synth Biol. 2014 Aug 15;3(8):515-24. doi: 10.1021/sb4001728. Epub 2014 Jan 14. 10.1021/sb4001728 PubMed 25126893
Map uploaded by the depositor.
