Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAM-PAT-ProCDKA;1::CDKA;1:YFP
(Plasmid #80685)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80685 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Binary vector pAMPAT-MCS
  • Modifications to backbone
    exchange of Pro35S to ProCDKA;1
  • Vector type
    Plant Expression
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CDKA;1
  • Alt name
    Cdc2a
  • Species
    A. thaliana (mustard weed)
  • Entrez Gene
    CDC2 (a.k.a. AT3G48750, CDC2A, CDC2AAT, CDK2, CDKA1, CDKA;1, CYCLIN-DEPENDENT KINASE A;1, P34CDC2, cell division control 2)
  • Promoter ProCDKA;1
  • Tag / Fusion Protein
    • YFP (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gaccggcaacaggattcaatcttaag
  • 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM-PAT-ProCDKA;1::CDKA;1:YFP was a gift from Nico Dissmeyer & Arp Schnittger (Addgene plasmid # 80685 ; http://n2t.net/addgene:80685 ; RRID:Addgene_80685)
  • For your References section:

    Bypassing genomic imprinting allows seed development. Nowack MK, Shirzadi R, Dissmeyer N, Dolf A, Endl E, Grini PE, Schnittger A. Nature. 2007 May 17;447(7142):312-5. Epub 2007 Apr 29. 10.1038/nature05770 PubMed 17468744