Skip to main content

pAM-PAT-ProGL2 GW
(Plasmid #80689)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80689 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Binary vector pAMPAT-MCS
  • Modifications to backbone
    exchange of Pro35S to ProGL2
  • Vector type
    Plant Expression
  • Promoter ProGL2
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gaccggcaacaggattcaatcttaag
  • 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Martin Hülskamp, Daniel Buoyer

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM-PAT-ProGL2 GW was a gift from Nico Dissmeyer & Arp Schnittger (Addgene plasmid # 80689 ; http://n2t.net/addgene:80689 ; RRID:Addgene_80689)
  • For your References section:

    Novel functions of plant cyclin-dependent kinase inhibitors, ICK1/KRP1, can act non-cell-autonomously and inhibit entry into mitosis. Weinl C, Marquardt S, Kuijt SJ, Nowack MK, Jakoby MJ, Hulskamp M, Schnittger A. Plant Cell. 2005 Jun;17(6):1704-22. Epub 2005 Mar 4. 10.1105/tpc.104.030486 PubMed 15749764