pIRES-EGFP2-AXL-Y634F
(Plasmid
#80842)
-
PurposeContains GFP-tagged AXL insert with Y634F mutation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneIRES2-EGFP
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 5308
- Total vector size (bp) 7927
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418) ; EGFP
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTyrosine-protein kinase receptor UFO
-
Alt nameAXL
-
Alt nameUFO
-
Alt nameAXL oncogene
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2619
-
MutationY634F
-
GenBank IDAAH32229.1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NHeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CTGGTCGAGCTGGACGGCGACG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIRES-EGFP2-AXL-Y634F was a gift from Aaron Meyer (Addgene plasmid # 80842)