Skip to main content

pCRISPaint-HA-PuroR
(Plasmid #80959)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80959 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCRISPaint
  • Backbone manufacturer
    Veit Hornung group
  • Vector type
    gene tagging

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HA tag
  • Species
    Synthetic
  • Promoter none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CGATAGTACTAACATACGCTCTCCA
  • 3′ sequencing primer CACTGCATTCTAGTTGTGGTTTGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPaint-HA-PuroR was a gift from Veit Hornung (Addgene plasmid # 80959 ; http://n2t.net/addgene:80959 ; RRID:Addgene_80959)
  • For your References section:

    CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Schmid-Burgk JL, Honing K, Ebert TS, Hornung V. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. 10.1038/ncomms12338 PubMed 27465542