pRY003
(Plasmid
#81043)
-
PurposeHO endonuclease expression
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81043 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAG36
- Backbone size w/o insert (bp) 6123
-
Modifications to backbonepAG36 with Gal1/10 promoter added between CEN/ARS and HO added at EcoR1 site
-
Vector typeYeast Expression
-
Selectable markersNAT (select with Nourseothricin/clonNAT)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHO
- Promoter endogenous
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (unknown if destroyed)
- 3′ cloning site EcoR1 (unknown if destroyed)
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid contains HO with its endogenous promoter amplified from yCP50-HO with oligos :
HO-EcoR1 5'
GCCCTTTCGTCTTCAAGAAT
HO-EcoR1 3'
CCATACCCACGCCGAAACGAATTCAC
Note on YCp50: HO sequence is as published in Meiron et al, Curr Genetics 1995, 367-373. Original source of plasmid may be from reference Jensen et al, 1983, Proc Natl Acad Sci USA 80: 3035-3039.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRY003 was a gift from John McCusker (Addgene plasmid # 81043 ; http://n2t.net/addgene:81043 ; RRID:Addgene_81043)