Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pRY003
(Plasmid #81043)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 81043 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAG36
  • Backbone size w/o insert (bp) 6123
  • Modifications to backbone
    pAG36 with Gal1/10 promoter added between CEN/ARS and HO added at EcoR1 site
  • Vector type
    Yeast Expression
  • Selectable markers
    NAT (select with Nourseothricin/clonNAT)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HO
  • Promoter endogenous

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (unknown if destroyed)
  • 3′ cloning site EcoR1 (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid contains HO with its endogenous promoter amplified from yCP50-HO with oligos :

HO-EcoR1 5'
GCCCTTTCGTCTTCAAGAAT

HO-EcoR1 3'
CCATACCCACGCCGAAACGAATTCAC

Note on YCp50: HO sequence is as published in Meiron et al, Curr Genetics 1995, 367-373. Original source of plasmid may be from reference Jensen et al, 1983, Proc Natl Acad Sci USA 80: 3035-3039.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRY003 was a gift from John McCusker (Addgene plasmid # 81043 ; http://n2t.net/addgene:81043 ; RRID:Addgene_81043)