Skip to main content

N174-MCS (Puro)
(Plasmid #81068)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 81068 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    N174-MCS
  • Backbone manufacturer
    Homemade
  • Backbone size (bp) 8653
  • Modifications to backbone
    Replaced neomycin with puromycin.
  • Vector type
    Mammalian Expression, Lentiviral
  • Promoter EF-1α
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
  • 3′ sequencing primer GTGGATGTGGAATGTGTGCGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N174-MCS (Puro) was a gift from Adam Karpf (Addgene plasmid # 81068 ; http://n2t.net/addgene:81068 ; RRID:Addgene_81068)