Skip to main content

pSico-shRaptor
(Plasmid #81086)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 81086 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSico
  • Backbone manufacturer
    Jacks Lab
  • Backbone size w/o insert (bp) 7566
  • Total vector size (bp) 7607
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Raptor shRNA
  • Alt name
    Rptor shRNA
  • gRNA/shRNA sequence
    GCCCGAGTCTGTGAATGTAAT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Rptor (a.k.a. 4932417H02Rik, Rap, Raptor, mKIAA1303)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer EGFP-C
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pSico was obtained from Addgene (plasmid 11578). shRNA insert was synthesized independently but is based on a target sequence from the Broad RNAi Platform (TRCN0000077472).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pSico allows for conditional (Cre-Lox), stable expression of shRaptor. Addition of Cre excises GFP and allows for shRaptor expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSico-shRaptor was a gift from Angelique Bordey (Addgene plasmid # 81086 ; http://n2t.net/addgene:81086 ; RRID:Addgene_81086)
  • For your References section:

    mTORC1 targets the translational repressor 4E-BP2, but not S6 kinase 1/2, to regulate neural stem cell self-renewal in vivo. Hartman NW, Lin TV, Zhang L, Paquelet GE, Feliciano DM, Bordey A. Cell Rep. 2013 Oct 31;5(2):433-44. doi: 10.1016/j.celrep.2013.09.017. Epub 2013 Oct 17. 10.1016/j.celrep.2013.09.017 PubMed 24139800