pSico-shRaptor
(Plasmid
#81086)
-
Purposeconditional expression of an shRNA targeting murine Raptor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 81086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSico
-
Backbone manufacturerJacks Lab
- Backbone size w/o insert (bp) 7566
- Total vector size (bp) 7607
-
Vector typeMammalian Expression, Lentiviral, RNAi, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRaptor shRNA
-
Alt nameRptor shRNA
-
gRNA/shRNA sequenceGCCCGAGTCTGTGAATGTAAT
-
SpeciesM. musculus (mouse)
-
Entrez GeneRptor (a.k.a. 4932417H02Rik, Rap, Raptor, mKIAA1303)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer EGFP-C (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypSico was obtained from Addgene (plasmid 11578). shRNA insert was synthesized independently but is based on a target sequence from the Broad RNAi Platform (TRCN0000077472).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pSico allows for conditional (Cre-Lox), stable expression of shRaptor. Addition of Cre excises GFP and allows for shRaptor expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSico-shRaptor was a gift from Angelique Bordey (Addgene plasmid # 81086 ; http://n2t.net/addgene:81086 ; RRID:Addgene_81086) -
For your References section:
mTORC1 targets the translational repressor 4E-BP2, but not S6 kinase 1/2, to regulate neural stem cell self-renewal in vivo. Hartman NW, Lin TV, Zhang L, Paquelet GE, Feliciano DM, Bordey A. Cell Rep. 2013 Oct 31;5(2):433-44. doi: 10.1016/j.celrep.2013.09.017. Epub 2013 Oct 17. 10.1016/j.celrep.2013.09.017 PubMed 24139800