Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #81124)


Item Catalog # Description Quantity Price (USD)
Plasmid 81124 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Promoter Pcpt

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTTCCGGCTCGTATGTTGTG
  • 3′ sequencing primer TTGGGTAACGCCAGGGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEZ01 was a gift from Brian Pfleger (Addgene plasmid # 81124 ; ; RRID:Addgene_81124)
  • For your References section:

    Construction of new synthetic biology tools for the control of gene expression in the cyanobacterium Synechococcus sp. strain PCC 7002. Zess EK, Begemann MB, Pfleger BF. Biotechnol Bioeng. 2016 Feb;113(2):424-32. doi: 10.1002/bit.25713. Epub 2015 Sep 3. 10.1002/bit.25713 PubMed 26192329