pEZ13
(Plasmid
#81139)
-
PurposepACSA_PEZ5_gfp
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 81139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepACSA
- Total vector size (bp) 4866
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
- Promoter PEZ5
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTCCGGCTCGTATGTTGTG
- 3′ sequencing primer TTGGGTAACGCCAGGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEZ13 was a gift from Brian Pfleger (Addgene plasmid # 81139 ; http://n2t.net/addgene:81139 ; RRID:Addgene_81139) -
For your References section:
Construction of new synthetic biology tools for the control of gene expression in the cyanobacterium Synechococcus sp. strain PCC 7002. Zess EK, Begemann MB, Pfleger BF. Biotechnol Bioeng. 2016 Feb;113(2):424-32. doi: 10.1002/bit.25713. Epub 2015 Sep 3. 10.1002/bit.25713 PubMed 26192329