Skip to main content

pSALECTNK-TEM1(S70A,D179G)/csTEM1
(Plasmid #81163)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 81163 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSALECT
  • Backbone size w/o insert (bp) 3224
  • Total vector size (bp) 4013
  • Modifications to backbone
    Addition of a codon-swapped fusion beta-lactamase with a c-terminal Hix6x tag followed by a BbvCI nicking site.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For plasmid production a general cloning strain with this plasmid can grown at 30 or 37oC. For selection on ampicillin the temperature is limited to 30oC in a strain that has lacI knocked-out (the strain MC4100 is best suited for this).
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TEM-1 beta-lactamase
  • Species
    Synthetic
  • Insert Size (bp)
    789
  • Mutation
    Deleted the sec transport tag. Plasmid encodes H26 to W290. Mutations S70A, D179G.
  • GenBank ID
    WP_054579850
  • Promoter lac promoter
  • Tags / Fusion Proteins
    • Codon swapped TEM-1 from H26 to W290 (C terminal on backbone)
    • His6x (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GGTTTCCCGACTGGAAAG
  • 3′ sequencing primer AGGGCAGGGTCGTTAAATAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSALECTNK-TEM1(S70A,D179G)/csTEM1 was a gift from Timothy Whitehead (Addgene plasmid # 81163 ; http://n2t.net/addgene:81163 ; RRID:Addgene_81163)
  • For your References section:

    Trade-offs between enzyme fitness and solubility illuminated by deep mutational scanning. Klesmith JR, Bacik JP, Wrenbeck EE, Michalczyk R, Whitehead TA. Proc Natl Acad Sci U S A. 2017 Feb 14. pii: 201614437. doi: 10.1073/pnas.1614437114. 10.1073/pnas.1614437114 PubMed 28196882