pETconNK-LGK
(Plasmid
#81165)
-
PurposepETconNK with levoglucosan kinase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81165 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETconNK
- Backbone size w/o insert (bp) 6109
- Total vector size (bp) 7423
-
Modifications to backboneStarting with pETcon the ampicillin resistance gene was swapped with kanamycin with the BbvCI nicking site 3' of the KanR gene. The nicking sequence CCTCAGCAA is on the coding strand.
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLevoglucosan kinase wild-type
-
Alt nameB3VI55_LIPST
-
SpeciesSynthetic; Lipomyces starkeyi
-
Insert Size (bp)1317
-
GenBank IDACE79748.1 EU751287.1
- Promoter GAL1
-
Tag
/ Fusion Protein
- c-myc (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGACAATAGCTCGACGATTGAAGGTAGATACCCATA
- 3′ sequencing primer TAATACGACTCACTATAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETconNK-LGK was a gift from Timothy Whitehead (Addgene plasmid # 81165 ; http://n2t.net/addgene:81165 ; RRID:Addgene_81165) -
For your References section:
Trade-offs between enzyme fitness and solubility illuminated by deep mutational scanning. Klesmith JR, Bacik JP, Wrenbeck EE, Michalczyk R, Whitehead TA. Proc Natl Acad Sci U S A. 2017 Feb 14. pii: 201614437. doi: 10.1073/pnas.1614437114. 10.1073/pnas.1614437114 PubMed 28196882