-
Purpose(Empty Backbone) pETconNK Empty Backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETconNK
- Backbone size (bp) 6137
-
Modifications to backboneStarting with pETcon the ampicillin resistance gene was swapped with kanamycin with the BbvCI nicking site 3' of the KanR gene. The nicking sequence CCTCAGCAA is on the coding strand.
-
Vector typeBacterial Expression, Yeast Expression
- Promoter GAL1
-
Selectable markersTRP1
-
Tag
/ Fusion Protein
- c-myc (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGACAATAGCTCGACGATTGAAGGTAGATACCCATA
- 3′ sequencing primer CAAGTCCTCTTCAGAAATAAGCTTTTGTTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETconNK was a gift from Timothy Whitehead (Addgene plasmid # 81169 ; http://n2t.net/addgene:81169 ; RRID:Addgene_81169) -
For your References section:
Trade-offs between enzyme fitness and solubility illuminated by deep mutational scanning. Klesmith JR, Bacik JP, Wrenbeck EE, Michalczyk R, Whitehead TA. Proc Natl Acad Sci U S A. 2017 Feb 14. pii: 201614437. doi: 10.1073/pnas.1614437114. 10.1073/pnas.1614437114 PubMed 28196882