pCALNL-eGFP-NT1-6-gix-6-NT1
(Plasmid
#81204)
-
Purposecontains two target sites consisting of PAM-NT1-6bp-gix psuedo site-6bp-NT1-PAM flanking a kan/pA as previously described in the pCALNL-eGFP plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCALNL
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 7000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegix-Neo-gix deletion cassette upstream of EGFP
-
SpeciesSynthetic
- Promoter pCBa
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- 3′ sequencing primer CGCATCGAGCGAGCAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCALNL-eGFP-NT1-6-gix-6-NT1 was a gift from David Liu (Addgene plasmid # 81204 ; http://n2t.net/addgene:81204 ; RRID:Addgene_81204) -
For your References section:
A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Chaikind B, Bessen JL, Thompson DB, Hu JH, Liu DR. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. 10.1093/nar/gkw707 PubMed 27515511