pCALNL-eGFP-Esp3I
(Plasmid
#81226)
-
PurposeCloning plasmid derived from loxP reporter. The Kan and pA where digested and removed with XhoI/MluI and replaced with two Esp3I sites
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCALNL
- Backbone size w/o insert (bp) 5600
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEsp31-Neo-Esp31 deletion cassette upstream of EGFP
-
SpeciesSynthetic
- Promoter pCBa
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp31 (not destroyed)
- 3′ cloning site Esp31 (not destroyed)
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- 3′ sequencing primer CGCATCGAGCGAGCAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCALNL-eGFP-Esp3I was a gift from David Liu (Addgene plasmid # 81226 ; http://n2t.net/addgene:81226 ; RRID:Addgene_81226) -
For your References section:
A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Chaikind B, Bessen JL, Thompson DB, Hu JH, Liu DR. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. 10.1093/nar/gkw707 PubMed 27515511