Skip to main content

pSB8
(Plasmid #82037)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82037 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKG116
  • Backbone size w/o insert (bp) 4211
  • Total vector size (bp) 5796

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Encodes the hybrid receptor of E. coli chemoreceptor Tar and histidine kinase CitA: CitA[1-193]-Tar[204-553]
  • Species
    E. coli
  • Insert Size (bp)
    1632

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGGGCGCAATATTCATGTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB8 was a gift from Victor Sourjik (Addgene plasmid # 82037 ; http://n2t.net/addgene:82037 ; RRID:Addgene_82037)
  • For your References section:

    Engineering Hybrid Chemotaxis Receptors in Bacteria. Bi S, Pollard AM, Yang Y, Jin F, Sourjik V. ACS Synth Biol. 2016 Jun 10. 10.1021/acssynbio.6b00053 PubMed 27285081