Skip to main content

pGAPTrap-Clover-Muro
(Plasmid #82334)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82334 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGAPTrap
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Clover-T2AMuro
  • Species
    Synthetic
  • Insert Size (bp)
    1406

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (destroyed during cloning)
  • 3′ cloning site Cla1 (not destroyed)
  • 5′ sequencing primer caacagggtggtggacctcatg
  • 3′ sequencing primer cctcttcaaggggtctacatgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGAPTrap-Clover-Muro was a gift from Ed Stanley (Addgene plasmid # 82334 ; http://n2t.net/addgene:82334 ; RRID:Addgene_82334)
  • For your References section:

    GAPTrap: A Simple Expression System for Pluripotent Stem Cells and Their Derivatives. Kao T, Labonne T, Niclis JC, Chaurasia R, Lokmic Z, Qian E, Bruveris FF, Howden SE, Motazedian A, Schiesser JV, Costa M, Sourris K, Ng E, Anderson D, Giudice A, Farlie P, Cheung M, Lamande SR, Penington AJ, Parish CL, Thomson LH, Rafii A, Elliott DA, Elefanty AG, Stanley EG. Stem Cell Reports. 2016 Sep 1. pii: S2213-6711(16)30139-4. doi: 10.1016/j.stemcr.2016.07.015. 10.1016/j.stemcr.2016.07.015 PubMed 27594589