Skip to main content

pUltra-sY
(Plasmid #82417)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82417 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUltra
  • Backbone size w/o insert (bp) 4056
  • Total vector size (bp) 4977
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Pick medium/small colonies from LB Agar plates. The SS320 and C321.ΔA (Addgene catalog ID: 48998) strains were used in the associated publication.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Methanococcus jannaschii aaRS for sulfotyrosine
  • Alt name
    STyrRS
  • Species
    methanococcus jannaschii
  • Insert Size (bp)
    921
  • Mutation
    Tyr32Leu, Leu65Pro, Asp158Gly, Ile159Cys, Leu162Lys
  • Promoter tacI

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TCGTATAATGTGTGGAATTG
  • 3′ sequencing primer TGATGACTCTCCAGAAGAGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Peter Schultz
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUltra-sY was a gift from Chang Liu (Addgene plasmid # 82417 ; http://n2t.net/addgene:82417 ; RRID:Addgene_82417)
  • For your References section:

    A second-generation expression system for tyrosine-sulfated proteins and its application in crop protection. Schwessinger B, Li X, Ellinghaus TL, Chan LJ, Wei T, Joe A, Thomas N, Pruitt R, Adams PD, Chern MS, Petzold CJ, Liu CC, Ronald PC. Integr Biol (Camb). 2016 Apr 18;8(4):542-5. doi: 10.1039/c5ib00232j. Epub 2015 Nov 27. 10.1039/c5ib00232j PubMed 26611838