Skip to main content

pMCh-1474
(Plasmid #82420)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82420 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCiNeo
  • Backbone size w/o insert (bp) 5470
  • Total vector size (bp) 8956
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nvGW182 NED
  • Species
    Nematostella vectensis
  • Insert Size (bp)
    3486
  • Mutation
    deleted amino acids 1159-1698 from nvGW182
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CACAGGTGTCCACTCCCAGTTC
  • 3′ sequencing primer ACTGCATTCTAGTTGTGGTTTGTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCh-1474 was a gift from Marina Chekulaeva (Addgene plasmid # 82420 ; http://n2t.net/addgene:82420 ; RRID:Addgene_82420)
  • For your References section:

    Conservation of miRNA-mediated silencing mechanisms across 600 million years of animal evolution. Mauri M, Kirchner M, Aharoni R, Ciolli Mattioli C, van den Bruck D, Gutkovitch N, Modepalli V, Selbach M, Moran Y, Chekulaeva M. Nucleic Acids Res. 2016 Sep 6. pii: gkw792. 10.1093/nar/gkw792 PubMed 27604873