pMCh-1498
(Plasmid
#82427)
-
PurposePlasmid for expression of NHA-tagged Nematostella vectensis GW182 11W11A in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 82427 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCiNeo
- Backbone size w/o insert (bp) 5557
- Total vector size (bp) 10664
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenvGW182 11W11A
-
SpeciesNematostella vectensis
-
Insert Size (bp)5107
-
MutationTrp 1167, 1183, 1227, 1309, 1391, 1453, 1574, 1589, 1627, 1638, 1657 were mutated to Ala
- Promoter CMV
-
Tag
/ Fusion Protein
- NHA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CACAGGTGTCCACTCCCAGTTC
- 3′ sequencing primer ACTGCATTCTAGTTGTGGTTTGTCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCh-1498 was a gift from Marina Chekulaeva (Addgene plasmid # 82427 ; http://n2t.net/addgene:82427 ; RRID:Addgene_82427) -
For your References section:
Conservation of miRNA-mediated silencing mechanisms across 600 million years of animal evolution. Mauri M, Kirchner M, Aharoni R, Ciolli Mattioli C, van den Bruck D, Gutkovitch N, Modepalli V, Selbach M, Moran Y, Chekulaeva M. Nucleic Acids Res. 2016 Sep 6. pii: gkw792. 10.1093/nar/gkw792 PubMed 27604873