-
PurposeDendra2 expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 82436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX6P-1
-
Backbone manufacturerAmersham
- Backbone size w/o insert (bp) 5038
- Total vector size (bp) 5755
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDendra2
-
SpeciesSynthetic
- Promoter tac
-
Tag
/ Fusion Protein
- GST tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TATAGCATGGCCTTTGCAGGG
- 3′ sequencing primer ttcaccgtcatcaccgaaac
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Dendra2 gene was obtained from Evrogen.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P-1-Dendra2 was a gift from Periklis Pantazis (Addgene plasmid # 82436 ; http://n2t.net/addgene:82436 ; RRID:Addgene_82436) -
For your References section:
Labeling cellular structures in vivo using confined primed conversion of photoconvertible fluorescent proteins. Mohr MA, Argast P, Pantazis P. Nat Protoc. 2016 Dec;11(12):2419-2431. doi: 10.1038/nprot.2016.134. Epub 2016 Nov 3. 10.1038/nprot.2016.134 PubMed 27809312