tPA-Dendra2
(Plasmid
#82636)
-
PurposeExpresses fluorescent hybrid of tPA for PALM imaging
-
Depositing Lab
-
Depositing OrganizationLewis & Clark College
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 82636 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 82636-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 82636-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneJPA5
-
Backbone manufacturerDr. John Adelman
- Backbone size w/o insert (bp) 5410
- Total vector size (bp) 7087
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTissue plasminogen activator
-
Alt nametPA
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1677
- Promoter HCMV
-
Tag
/ Fusion Protein
- Dendra2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (unknown if destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGTGACACTATAGAATAACATCCACTTTGC
- 3′ sequencing primer GAGTTTGGACAAACCACAACTAGAATGCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that, compared to the Entrez Genbank reference for rat tPA, this plasmid has a E380K amino acid residue substitution.
DNA (Catalog # 82636-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 82636-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tPA-Dendra2 was a gift from Janis Lochner (Addgene plasmid # 82636 ; http://n2t.net/addgene:82636 ; RRID:Addgene_82636) -
For your References section:
Super-resolution imaging of neuronal dense-core vesicles. Scalettar BA, Shaver D, Kaech S, Lochner JE. J Vis Exp. 2014 Jul 2;(89). doi: 10.3791/51394. 10.3791/51394 PubMed 25046659