tPA-Dendra2
(Plasmid
#82636)
-
PurposeExpresses fluorescent hybrid of tPA for PALM imaging
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82636 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneJPA5
-
Backbone manufacturerDr. John Adelman
- Backbone size w/o insert (bp) 5410
- Total vector size (bp) 7087
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTissue plasminogen activator
-
Alt nametPA
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1677
- Promoter HCMV
-
Tag
/ Fusion Protein
- Dendra2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (unknown if destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGTGACACTATAGAATAACATCCACTTTGC
- 3′ sequencing primer GAGTTTGGACAAACCACAACTAGAATGCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that, compared to the Entrez Genbank reference for rat tPA, this plasmid has a E380K amino acid residue substitution.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tPA-Dendra2 was a gift from Janis Lochner (Addgene plasmid # 82636 ; http://n2t.net/addgene:82636 ; RRID:Addgene_82636) -
For your References section:
Super-resolution imaging of neuronal dense-core vesicles. Scalettar BA, Shaver D, Kaech S, Lochner JE. J Vis Exp. 2014 Jul 2;(89). doi: 10.3791/51394. 10.3791/51394 PubMed 25046659
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/82/82636/82636-map_9L1FPItNg_Tr.png.940x940_q85_autocrop.png)