-
Purposeexpress human caspase 8 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBabe
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 7116
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFv-Caspase 8-2A-GFP
-
Alt namedimerizale caspase 8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2016
-
Mutationdeleted amino acids 1-215 of caspase 8
-
GenBank IDNM_001080125.1
-
Entrez GeneCASP8 (a.k.a. ALPS2B, CAP4, Casp-8, FLICE, MACH, MCH5)
- Promoter LTR
-
Tag
/ Fusion Protein
- FKBP dimerization domain (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer ctttatccagccctcac
- 3′ sequencing primer accctaactgacacacattcc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fv-hCaspase 8-2A-GFP was a gift from Douglas Green (Addgene plasmid # 82712) -
For your References section:
Inducible dimerization and inducible cleavage reveal a requirement for both processes in caspase-8 activation. Oberst A, Pop C, Tremblay AG, Blais V, Denault JB, Salvesen GS, Green DR. J Biol Chem. 2010 May 28;285(22):16632-42. doi: 10.1074/jbc.M109.095083. Epub 2010 Mar 22. 10.1074/jbc.M109.095083 PubMed 20308068