Skip to main content

pGrDL_SPb
(Plasmid #83205)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83205 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGrDL_SP
  • Backbone manufacturer
    Richard Moyle
  • Backbone size w/o insert (bp) 7086
  • Total vector size (bp) 7769
  • Modifications to backbone
    replaced NOS promoter with a tomato ACTIN promoter to drive expression of the Renilla luciferase
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tomato ACTIN promoter
  • Species
    Tomato
  • Insert Size (bp)
    1007
  • Promoter Tomato ACTIN

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site FSPI (unknown if destroyed)
  • 3′ cloning site PSPXI (destroyed during cloning)
  • 5′ sequencing primer ccactgcggaccagttatcatcc
  • 3′ sequencing primer cgccagctggcgtaatagc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGrDL_SPb was a gift from Peer Schenk (Addgene plasmid # 83205 ; http://n2t.net/addgene:83205 ; RRID:Addgene_83205)
  • For your References section:

    An Optimized Transient Dual Luciferase Assay for Quantifying MicroRNA Directed Repression of Targeted Sequences. Moyle RL, Carvalhais LC, Pretorius LS, Nowak E, Subramaniam G, Dalton-Morgan J, Schenk PM. Front Plant Sci. 2017 Sep 20;8:1631. doi: 10.3389/fpls.2017.01631. eCollection 2017. 10.3389/fpls.2017.01631 PubMed 28979287