pSELECT-HA-mFOXO1-D256
(Plasmid #83379)

• Purpose: expresses mouse FOXO1 with truncating mutation at AA 256 in mammalian cells
• Depositing Lab: Steven Abcouwer
• Publication: pSELECT-HA-mFOXO1-D256 (unpublished)

Backbone

• Vector backbone: pSELECT-puro
• Backbone manufacturer: Invivogen
• Backbone size w/o insert (bp): 3390
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): None
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Forkhead box O1
• Alt name: FoxO1
• Species: M. musculus (mouse)
• Insert Size (bp): 768
• Mutation: N256TAG (premature stop codon)
• GenBank ID: NM_019739.3
• Entrez Gene: Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
• Promoter: EF-1a
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GACCCTGCTTGCTCAACTCT
• 3′ sequencing primer: GAGCTCAGCCGAGAAGAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: FOXO1-D256 was cloned from Myc-FOXO1 D256 containing dominant-negative mouse FOXO1 truncation mutant ORF fused to myc-tag was obtained from AddGene (plasmid 12145) originally constructed by Nakae and coworkers (EMBO J 19:989, 2000)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • InvivoGen Limited Use Label License
• Industry Terms:
  • Not Available to Industry