His8:MBP-tev-Lys-eK-Flv
(Plasmid
#83387)
-
Purposebacterial expression vector pVP16 containing a derivative of E. coli lacZ fused with E. coli flavin binding protein MioC to be used in N-end rule in vitro ubiquitination studies
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83387 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepVP16
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)BL21
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameflavin binding protein MioC
-
SpeciesE. coli
-
Insert Size (bp)450
-
GenBank IDWP_080028772.1
-
Tags
/ Fusion Proteins
- 8xHis (N terminal on backbone)
- MBP (N terminal on backbone)
- 3xHA (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gatgtccgctttctggtatgc
- 3′ sequencing primer GTTCTGAGGTCATTACTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His8:MBP-tev-Lys-eK-Flv was a gift from Nico Dissmeyer (Addgene plasmid # 83387 ; http://n2t.net/addgene:83387 ; RRID:Addgene_83387)