Skip to main content

His8:MBP-tev-Ile-eK-Flv
(Plasmid #83392)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83392 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pVP16
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BL21
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    flavin binding protein MioC
  • Species
    E. coli
  • Insert Size (bp)
    450
  • GenBank ID
    WP_080028772.1
  • Tags / Fusion Proteins
    • 8xHis (N terminal on backbone)
    • MBP (N terminal on backbone)
    • 3xHA (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gatgtccgctttctggtatgc
  • 3′ sequencing primer GTTCTGAGGTCATTACTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    His8:MBP-tev-Ile-eK-Flv was a gift from Nico Dissmeyer (Addgene plasmid # 83392 ; http://n2t.net/addgene:83392 ; RRID:Addgene_83392)
  • For your References section:

    Real-time detection of N-end rule-mediated ubiquitination via fluorescently labeled substrate probes. Mot AC, Prell E, Klecker M, Naumann C, Faden F, Westermann B, Dissmeyer N. New Phytol. 2017 Mar 9. doi: 10.1111/nph.14497. 10.1111/nph.14497 PubMed 28277608