Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

His8:MBP-tev-Arg-eΔK-Flv
(Plasmid #83396)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 83396 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pVP16
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BL21
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    flavin binding protein MioC
  • Species
    E. coli
  • Insert Size (bp)
    450
  • GenBank ID
    WP_080028772.1
  • Tags / Fusion Proteins
    • 8xHis (N terminal on backbone)
    • MBP (N terminal on backbone)
    • 3xHA (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gatgtccgctttctggtatgc
  • 3′ sequencing primer GTTCTGAGGTCATTACTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    His8:MBP-tev-Arg-eΔK-Flv was a gift from Nico Dissmeyer (Addgene plasmid # 83396 ; http://n2t.net/addgene:83396 ; RRID:Addgene_83396)