pVP16-tev-PRT1-V28A
(Plasmid
#83406)
-
Purposebacterial expression vector pVP16 containing a mutant variant of Arabidopsis thaliana PROTEOLYSIS 1 (PRT1) N-end rule E3 ubiquitin ligase to be used in N-end rule in vitro ubiquitination studies
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepVP16
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)BL21
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePROTEOLYSIS1 (PRT1)
-
SpeciesA. thaliana (mustard weed); E. coli
-
Insert Size (bp)450
-
MutationV28A substitution
-
GenBank ID822078
-
Entrez GenePRT1 (a.k.a. AT3G24800, proteolysis 1)
-
Tags
/ Fusion Proteins
- His8 (N terminal on backbone)
- MBP (N terminal on backbone)
- tev cleavage site (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gatgtccgctttctggtatgc
- 3′ sequencing primer GTTCTGAGGTCATTACTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVP16-tev-PRT1-V28A was a gift from Nico Dissmeyer (Addgene plasmid # 83406 ; http://n2t.net/addgene:83406 ; RRID:Addgene_83406)