Skip to main content
Addgene

pUC-TALO8
(Plasmid #83409)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83409 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC
  • Backbone manufacturer
    unknown
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    grow at 30 °C in the presence of 1 mM IPTG in both plate and liquid media, in order to keep eight copies of LacO. Upon maxi-prep, we test the copy number of LacO by PCR using the following primers: R-20: CAGCTATGACCATGATTACG pDTL11: AATGCGAGATCCGTTTAAC
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TRP-ARS-8xLacO
  • Species
    Synthetic
  • Mutation
    Please see depositor comments below
  • Promoter TRP1

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note- Addgene's quality control full plasmid sequence found
several single A->G mismatches in lacO sites 5 and 7. The depositor noted that these discrepancies do NOT affect plasmid function.

To transform yeast, we remove pUC backbone by cutting pUC-TALO8 with EcoRI, isolating ~1.7 kb fragment, and self-ligating it in vitro. We then directly transform yeast with the ligation mixture.
Purification protocol can be found here:
http://research.fhcrc.org/content/dam/stripe/tsukiyama/files/Protocols/TALO8_Protocol.pdf

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC-TALO8 was a gift from Toshi Tsukiyama (Addgene plasmid # 83409 ; http://n2t.net/addgene:83409 ; RRID:Addgene_83409)
  • For your References section:

    Dynamic changes in histone acetylation regulate origins of DNA replication. Unnikrishnan A, Gafken PR, Tsukiyama T. Nat Struct Mol Biol. 2010 Apr;17(4):430-7. doi: 10.1038/nsmb.1780. Epub 2010 Mar 14. 10.1038/nsmb.1780 PubMed 20228802