pUC-TALO8
(Plasmid
#83409)
-
PurposeTRP1-ARS1-8xLacO (TALO8) minichromosome system for histone purification in yeast
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
-
Backbone manufacturerunknown
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsgrow at 30 °C in the presence of 1 mM IPTG in both plate and liquid media, in order to keep eight copies of LacO. Upon maxi-prep, we test the copy number of LacO by PCR using the following primers: R-20: CAGCTATGACCATGATTACG pDTL11: AATGCGAGATCCGTTTAAC
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTRP-ARS-8xLacO
-
SpeciesSynthetic
-
MutationPlease see depositor comments below
- Promoter TRP1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer M13pUC-Fwd
- 3′ sequencing primer M13 Reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note- Addgene's quality control full plasmid sequence found
several single A->G mismatches in lacO sites 5 and 7. The depositor noted that these discrepancies do NOT affect plasmid function.
To transform yeast, we remove pUC backbone by cutting pUC-TALO8 with EcoRI, isolating ~1.7 kb fragment, and self-ligating it in vitro. We then directly transform yeast with the ligation mixture.
Purification protocol can be found here:
http://research.fhcrc.org/content/dam/stripe/tsukiyama/files/Protocols/TALO8_Protocol.pdf
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC-TALO8 was a gift from Toshi Tsukiyama (Addgene plasmid # 83409 ; http://n2t.net/addgene:83409 ; RRID:Addgene_83409) -
For your References section:
Dynamic changes in histone acetylation regulate origins of DNA replication. Unnikrishnan A, Gafken PR, Tsukiyama T. Nat Struct Mol Biol. 2010 Apr;17(4):430-7. doi: 10.1038/nsmb.1780. Epub 2010 Mar 14. 10.1038/nsmb.1780 PubMed 20228802