Skip to main content

pSpCas9(BB)-2A-Puro-SMCR8
(Plasmid #83440)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83440 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 62988)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA targeting human SMCR8
  • gRNA/shRNA sequence
    GATCAGCGCCCCTGACGTAG
  • Species
    H. sapiens (human)
  • Entrez Gene
    SMCR8 (a.k.a. DENND8A)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site bbsI (unknown if destroyed)
  • 3′ cloning site BbsI (unknown if destroyed)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9(BB)-2A-Puro-SMCR8 was a gift from Shawn Ferguson (Addgene plasmid # 83440 ; http://n2t.net/addgene:83440 ; RRID:Addgene_83440)
  • For your References section:

    C9orf72 binds SMCR8, localizes to lysosomes and regulates mTORC1 signaling. Amick J, Roczniak-Ferguson A, Ferguson SM. Mol Biol Cell. 2016 Aug 24. pii: mbc.E16-01-0003. 10.1091/mbc.E16-01-0003 PubMed 27559131