pSOD1E133insTT-AcGFP1
(Plasmid
#83441)
-
PurposeExpresses SOD1E133insTT in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83441 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAcGFP1-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5124
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOD1
-
SpeciesH. sapiens (human)
-
MutationE133insTT
-
Entrez GeneSOD1 (a.k.a. ALS, ALS1, HEL-S-44, IPOA, SOD, STAHP, hSod1, homodimer)
- Promoter CMV
-
Tag
/ Fusion Protein
- AcGFP1 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer AcGFP1_R (GGCCATTCACATCGCCATTC)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byElizabeth Fisher( pF147 pSOD1A4VAcGFP1, #26408)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutation (first described in PMID: 9065559) was created using the method described in PMID: 17446874. Two outer (F: GCTTCGAATTCCATGGCGAC, AcGFP1_R: GGCCATTCACATCGCCATTC) and two mutation-site primers were used. The mutated PCR product and the backbone vector were digested using EcoRI and SalI, gel purified and ligated. SOD1E133insTT mutation introduces a stop codon that disrupts AcGFP1 tag expression. To avoid this, a second round of PCR was done to clone SOD1E133insTT without the stop codon using the same forward primer, and the reverse primer GCTTCGGTCGACCCATCATTTCCACCTTTGCCCAAG, followed by restriction with EcoRI and SalI and ligation in the backbone.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSOD1E133insTT-AcGFP1 was a gift from Mohan Babu (Addgene plasmid # 83441 ; http://n2t.net/addgene:83441 ; RRID:Addgene_83441) -
For your References section:
A Map of Human Mitochondrial Protein Interactions Linked to Neurodegeneration Reveals New Mechanisms of Redox Homeostasis and NF-kappaB Signaling. Malty RH, Aoki H, Kumar A, Phanse S, Amin S, Zhang Q, Minic Z, Goebels F, Musso G, Wu Z, Abou-Tok H, Meyer M, Deineko V, Kassir S, Sidhu V, Jessulat M, Scott NE, Xiong X, Vlasblom J, Prasad B, Foster LJ, Alberio T, Garavaglia B, Yu H, Bader GD, Nakamura K, Parkinson J, Babu M. Cell Syst. 2017 Nov 7. pii: S2405-4712(17)30447-7. doi: 10.1016/j.cels.2017.10.010. 10.1016/j.cels.2017.10.010 PubMed 29128334