pPHAGE_DLD-H450A-C-TAP
(Plasmid
#83478)
-
PurposeMammalian expression of the dehydrogenase-deficient mutant DLD-H450A.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83478 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPHAGE C-TAP
-
Backbone manufacturerPMID: 26186194
- Backbone size w/o insert (bp) 10056
- Total vector size (bp) 9368
-
Modifications to backbonePartial removal of gateway cassette.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDLD
-
Alt nameDihydrolipoamide Dehydrogenase
-
SpeciesH. sapiens (human)
-
MutationH450A
-
GenBank IDNM_000108.4
-
Entrez GeneDLD (a.k.a. DLDD, DLDH, E3, GCSL, LAD, OGDC-E3, PHE3)
- Promoter CMV
-
Tag
/ Fusion Protein
- TAP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMV_F, mutation confirmation (CTCTTGGTTTGCATTGGCCG)
- 3′ sequencing primer IRES_R (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe plasmid was originally developed by authors of the paper PMID: 26186194.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutation (first described in PMID: 17404228) was created using the method described in PMID: 17446874. Two outer (F: CTCTTGGTTTGCATTGGCCG, IRES_R: CCTCACATTGCCAAAAGACG) and two mutation-site primers were used. The mutated PCR product and the backbone vector were digested using EcoRI, gel purified and ligated.
Note that the mutation is numbered in accordance with the original publication (PMID: 17404228), which lacked the mitochondrial targeting signal (residues 1-35). In this full-length protein, it is found at position 485.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPHAGE_DLD-H450A-C-TAP was a gift from Mohan Babu (Addgene plasmid # 83478 ; http://n2t.net/addgene:83478 ; RRID:Addgene_83478) -
For your References section:
A Map of Human Mitochondrial Protein Interactions Linked to Neurodegeneration Reveals New Mechanisms of Redox Homeostasis and NF-kappaB Signaling. Malty RH, Aoki H, Kumar A, Phanse S, Amin S, Zhang Q, Minic Z, Goebels F, Musso G, Wu Z, Abou-Tok H, Meyer M, Deineko V, Kassir S, Sidhu V, Jessulat M, Scott NE, Xiong X, Vlasblom J, Prasad B, Foster LJ, Alberio T, Garavaglia B, Yu H, Bader GD, Nakamura K, Parkinson J, Babu M. Cell Syst. 2017 Nov 7. pii: S2405-4712(17)30447-7. doi: 10.1016/j.cels.2017.10.010. 10.1016/j.cels.2017.10.010 PubMed 29128334