pCA24N_6xHis-TEV-rpsA
(Plasmid
#83585)
-
PurposeExpress E. coli ribosomal protein S1 with a TEV-cleavable, N-terminal His tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83585 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCA24N
- Backbone size w/o insert (bp) 4520
- Total vector size (bp) 6191
-
Modifications to backboneMutate amino acids downstream of His tag from TDPALRA to ENLYFQG to make TEV cleavage site. Remove last 5 C-terminal amino acids which are not present in rpsA.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse plates with 68 ug/mL chloramphenicol for transformation, then replate onto plates with 170 ug/mL if desired. When growing for protein expression, use 68 ug/mL antibiotic in liquid media.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerpsA
-
Alt nameribosomal protein S1
-
Alt nameJW0894
-
SpeciesEscherichia coli
-
GenBank IDNC_000913.3 (961995..963668) NP_415431
-
Entrez GenerpsA (a.k.a. b0911, ECK0902, ssyF)
- Promoter p-T5 Lac
-
Tag
/ Fusion Protein
- His tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (destroyed during cloning)
- 3′ cloning site SfiI (destroyed during cloning)
- 5′ sequencing primer caggaaacagctatgacc
- 3′ sequencing primer cgagcgttctgaacaaatcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe parent plasmid used as starting material for mutagenesis came from the ASKA library via Professor Janine Maddock (Molecular, Cellular & Developmental Biology, University of Michigan), under whose supervision this work was performed.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCA24N_6xHis-TEV-rpsA was a gift from Nils Walter (Addgene plasmid # 83585 ; http://n2t.net/addgene:83585 ; RRID:Addgene_83585) -
For your References section:
Protein unties the pseudoknot: S1-mediated unfolding of RNA higher order structure. Lund PE, Chatterjee S, Daher M, Walter NG. Nucleic Acids Res. 2019 Dec 13. pii: 5674991. doi: 10.1093/nar/gkz1166. 10.1093/nar/gkz1166 PubMed 31832686