Skip to main content

pLMB687
(Plasmid #83781)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83781 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIJ11268
  • Backbone manufacturer
    16260
  • Backbone size w/o insert (bp) 17558

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    E. coli S17-1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Region upstream pRL120556 containing all of pRL120555
  • Species
    Rhizobium leguminosarum bv. viciae, strain 3841
  • Insert Size (bp)
    1230

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CCATCTTTGCCCTACCGTAT
  • 3′ sequencing primer AAACCGACGCCATCACCCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLMB687 was a gift from Philip Poole (Addgene plasmid # 83781 ; http://n2t.net/addgene:83781 ; RRID:Addgene_83781)
  • For your References section:

    Bacterial Biosensors for in Vivo Spatiotemporal Mapping of Root Secretion. Pini F, East AK, Appia-Ayme C, Tomek J, Karunakaran R, Mendoza-Suarez M, Edwards A, Terpolilli JJ, Roworth J, Downie JA, Poole PS. Plant Physiol. 2017 Jul;174(3):1289-1306. doi: 10.1104/pp.16.01302. Epub 2017 May 11. 10.1104/pp.16.01302 PubMed 28495892