Skip to main content

pLMB737
(Plasmid #83790)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83790 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 83790-D50 50 μg of DNA in Tris buffer $495
DNA 83790-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pIJ11268
  • Backbone size w/o insert (bp) 16260
  • Total vector size (bp) 17488

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    E. coli S17-1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Region upstream RL0990 (matA) containing all of RL0989 (matR)
  • Species
    Rhizobium leguminosarum bv. viciae, strain 3841
  • Insert Size (bp)
    1228

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHi (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CCATCTTTGCCCTACCGTAT
  • 3′ sequencing primer AAACCGACGCCATCACCCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLMB737 was a gift from Philip Poole (Addgene plasmid # 83790 ; http://n2t.net/addgene:83790 ; RRID:Addgene_83790)
  • For your References section:

    Bacterial Biosensors for in Vivo Spatiotemporal Mapping of Root Secretion. Pini F, East AK, Appia-Ayme C, Tomek J, Karunakaran R, Mendoza-Suarez M, Edwards A, Terpolilli JJ, Roworth J, Downie JA, Poole PS. Plant Physiol. 2017 Jul;174(3):1289-1306. doi: 10.1104/pp.16.01302. Epub 2017 May 11. 10.1104/pp.16.01302 PubMed 28495892