pLMB737
(Plasmid
#83790)
-
PurposeMalonate biosensor plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83790 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIJ11268
- Backbone size w/o insert (bp) 16260
- Total vector size (bp) 17488
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)E. coli S17-1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRegion upstream RL0990 (matA) containing all of RL0989 (matR)
-
SpeciesRhizobium leguminosarum bv. viciae, strain 3841
-
Insert Size (bp)1228
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHi (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CCATCTTTGCCCTACCGTAT
- 3′ sequencing primer AAACCGACGCCATCACCCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLMB737 was a gift from Philip Poole (Addgene plasmid # 83790 ; http://n2t.net/addgene:83790 ; RRID:Addgene_83790) -
For your References section:
Bacterial Biosensors for in Vivo Spatiotemporal Mapping of Root Secretion. Pini F, East AK, Appia-Ayme C, Tomek J, Karunakaran R, Mendoza-Suarez M, Edwards A, Terpolilli JJ, Roworth J, Downie JA, Poole PS. Plant Physiol. 2017 Jul;174(3):1289-1306. doi: 10.1104/pp.16.01302. Epub 2017 May 11. 10.1104/pp.16.01302 PubMed 28495892